openapi: 3.0.1 info: title: DWT description: '' version: '20250428' tags: - name: Server Control - name: Scanner Control - name: Document Management - name: Document Processing paths: /server: get: summary: Get the server settings. deprecated: false description: | Get the server settings. Some settings can only be retrieved by the admin. operationId: getServerSettings tags: - Server Control parameters: [] responses: '200': description: Successful operation content: application/json: schema: $ref: '#/components/schemas/ServerSettings' example: logLevel: 1 headers: {} '405': description: Method not allowed content: application/json: schema: &ref_0 $ref: '#/components/schemas/Error' example: code: -2112 message: This endpoint only supports GET and PATCH. statusCode: 405 headers: {} security: [] patch: summary: Update only specified server settings. deprecated: false description: > Update only specified server settings. Some settings can only be updated by the admin. operationId: patchServerSettings tags: - Server Control parameters: [] requestBody: content: application/json: schema: $ref: '#/components/schemas/ServerSettingsInput' example: '' responses: '200': description: Successful operation content: application/json: schema: type: object properties: logLevel: type: integer format: int32 default: 0 description: server log level. example: logLevel: 1 headers: {} '400': description: Bad request. e.g. parameter is invalid. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET and PATCH. statusCode: 405 headers: {} security: [] /server/version: get: summary: Get the server API version. deprecated: false description: In the future, the client can pass the API version to call different API versions. operationId: getServerVersion tags: - Server Control parameters: [] responses: '200': description: Successful operation content: application/json: schema: type: object properties: version: type: string description: server API version. example: - '20240719' compatible: type: boolean description: server is compatible with the client. example: - true headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} security: [] /device/scanners: get: summary: Retrieve a list scanners deprecated: false description: '' operationId: getScanners tags: - Scanner Control parameters: - name: type in: query description: > Device type. It can be one type or a combination. The default uses TWAIN/TWAIN64/WIA/ICA/SANE. required: false schema: &ref_2 $ref: '#/components/schemas/ScannerType' description: one value of ScannerType example: - 16 responses: '200': description: Successful operation content: application/json: schema: type: array items: &ref_3 $ref: '#/components/schemas/Scanner' example: - name: TWAIN2 FreeImage Software Scanner type: 16 device: >- {"deviceInfo":{"Manufacturer":"VFdBSU4gV29ya2luZyBHcm91cA==","ProductFamily":"U29mdHdhcmUgU2Nhbg==","ProductName":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy","ProtocolMajor":2,"ProtocolMinor":1,"SupportedGroups":0,"Version":{"Country":1,"Info":"Mi4xLjMgc2FtcGxlIHJlbGVhc2UgMzJiaXQ=","Language":2,"MajorNum":2,"MinorNum":1}},"deviceType":16,"isSystemDefaultPrinter":false,"name":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy"} headers: {} '400': description: Bad request. e.g. parameter is invalid. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} security: [] /device/scanners/jobs: post: summary: Create a scan job deprecated: false description: > You can scan with the specified scanner. If the scanner is not specified, the last used scanner or the defalut scanner will be used. You can set capabilities of the scanner. You can show the scanner ui if you are operating on the machine running Dynamic Web TWAIN Service. You can get scanned image with the job uid, or save to the specified document. You can create a pending job with the specified scanner. One scanner can only have one pending job. If the scanner is shared, it is recommended to create a pending job for the specified scanner. Default other requests for the job will only allow the domain when job created. Once the job was created, you have to delete the job manually unless you set a jobTimeout and it times out. operationId: createScanJob tags: - Scanner Control parameters: - name: DWT-PRODUCT-KEY in: header description: Product key required: true example: '' schema: type: string requestBody: content: application/json: schema: $ref: '#/components/schemas/CreateScanJobOptions' example: '' responses: '201': description: Successful operation content: application/json: schema: $ref: '#/components/schemas/ScannerJob' headers: {} '400': description: Bad request. e.g. parameter is invalid. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: The license is invalid. content: application/json: schema: *ref_0 example: code: -2800 message: >- The current product key is empty or invalid. Please contact the site administrator. statusCode: 403 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports POST. statusCode: 405 headers: {} '423': description: The scanner is currently in use. content: application/json: schema: *ref_0 example: code: -1004 message: >- The source is connected to the maximum supported number of applications. statusCode: 423 headers: {} security: [] /device/scanners/jobs/{jobuid}: get: summary: Retrieve the scan job status. deprecated: false description: | You can get the job status. operationId: getScanJobStatus tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string responses: '200': description: Successful operation content: application/json: schema: type: object required: - status - code - message properties: status: type: string enum: - pending - running - completed - faulted - canceled description: scanner job status code: type: number description: error code default: '0' message: type: string description: error message default: Successful description: Scanner Job Information headers: {} '404': description: Error resonpse content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET, PATCH and DELETE. statusCode: 405 headers: {} '410': description: >- The job was deleted. If the service restarted and all the jobs were lost, it will return 404. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] patch: summary: Update the scan job status. deprecated: false description: > When the job status is pending, you can update the status of the job. Otherwise, it will be ignored. operationId: updateScanJob tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string requestBody: content: application/json: schema: type: object properties: status: type: string default: running enum: - running - canceled description: > Update the job status. If the job is running, it only accepts Canceled to cancel the job. If the job is pending, it only accepts Running to start the job. required: - status example: '' responses: '200': description: Successful operation content: application/json: schema: type: object properties: status: type: string enum: - running - canceled default: running description: scanner job status. required: - status headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET, PATCH and DELETE. statusCode: 405 headers: {} '409': description: >- When you try to cancel a not pending or running job, update a not pending job to running. content: application/json: schema: *ref_0 example: code: -1011 message: Operation out of expected sequence. statusCode: 409 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] delete: summary: Delete the scan job deprecated: false description: > If the job is running, the job will be canceled first, and then be deleted, including all scanned documents. operationId: deleteScanJob tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string responses: '204': description: Successful operation headers: {} '404': description: Error resonpse content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET, PATCH and DELETE. statusCode: 405 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/scanner/capabilities: get: summary: Retrieve the capabilities of the scanner specified in the scan job. deprecated: false description: > You can get the capabilities of scanner specified in the job, but it is only valid when the job is pending. operationId: getCurrentScannerCapabilities tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string - name: caps in: query description: '' required: false schema: type: string description: > capability id. multiple values seperated by commas. e.g. caps=5,2,1. If no pages specified, return all capabilities. externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Dynamsoft_Enum.html#dynamsoftDWTenumDWT_cap responses: '200': description: Successful operation content: application/json: schema: type: array externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Interfaces.html#capabilitydetails properties: {} items: type: object properties: {} headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '409': description: Support only when the scan job is pending. content: application/json: schema: *ref_0 example: code: -1011 message: Operation out of expected sequence. statusCode: 409 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/scanner/settings: get: summary: Retrieve the settings of the scanner specified in the scan job. deprecated: false description: > You can get the scanner settings. It only supports TWAIN scanners, and it is only valid when the job is pending. We will call EnableSourceUI to get the settings. operationId: getCurrentScannerSettings tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string - name: showui in: query description: '' required: false schema: type: boolean default: true description: > If true, will show the UI for the user to set the scanner settings. If false, will not show the UI. responses: '200': description: Successful operation content: application/json: schema: type: object properties: settings: type: string description: base64 encoded example: settings: >- Rfj6pIMTNkCu3BfDloGItBAAAAACEAAABgAFAAEAAAAQAAAAExAAAAYABQAAAAAAEAAAAAcQAAAGAAUAAQAAABAAAAArEQAABAAFABgAAAAQAAAAHBEAAAQABQAAAAAAEAAAAAABAAAEAAUAAAAAABwAAAAUEQAACAAFAPgqAAAAAAAANCEAAAAAAAAQAAAADBEAAAQABQACAAAAEAAAAB8RAAAEAAUAAAAAABAAAAABAQAABAAFAAIAAAAQAAAAIBEAAAQABQAAAAAAEAAAACIRAAAEAAUAAwAAABAAAAAQEQAABAAFAAAAAAAQAAAAAgEAAAQABQAAAAAAEAAAABgRAAAHAAUAAABIQxAAAAAZEQAABwAFAAAASEMQAAAAIxEAAAcABQAAAABDEAAAAAMRAAAHAAUAAAAAABAAAAABEQAABwAFAAAAAAAQAAAACBEAAAcABQAAAIA/EAAAAAGAAAAGAAUAAAAAAA== headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '409': description: The job is not in pending. content: application/json: schema: *ref_0 example: code: -1011 message: Operation out of expected sequence. statusCode: 409 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/next-page-info: get: summary: Get the next page information for a specific job. deprecated: false description: > Get the next scanned page info. If the scanned page is not ready, it will not return until the page is ready. If the response code is 200, we can try to get the next until the reponse code is 204. operationId: getNextScannedPageInfo tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string responses: '200': description: >- Successful operation. We will also return the image url; if scan to a document, also return document uid and page uid. content: application/json: schema: type: array items: $ref: '#/components/schemas/ScanDocumentInfo' headers: {} '204': description: No more pages. scan done. headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '410': description: The job was deleted. content: application/json: schema: type: object properties: {} example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} security: [] /device/scanners/jobs/{jobuid}/next-page: get: summary: Get the next page for a specific job. deprecated: false description: > Get the next scanned page content. If the scanned page is not ready, it will not return until the page is ready. If the response code is 200, we can try to get the next until the reponse code is 204. operationId: getNextScannedPage tags: - Scanner Control parameters: - name: jobuid in: path description: '' required: true example: '' schema: type: string - name: type in: query description: '' required: false schema: type: string enum: - image/jpeg - image/png default: image/png description: mime type responses: '200': description: Successful operation. return image/png or image/jpeg stream. content: image/jpeg: schema: type: object properties: {} example: "ÿØÿà \x10JFIF \x01\x01\x01 ` ` ÿá ZExif MM * \b \x05\x03\x01 \x05 \x01 J\x03\x03 \x01 \x01 Q\x10 \x01 \x01\x01 Q\x11 \x04 \x01 \x0EÃQ\x12 \x04 \x01 \x0Eà \x01†\_ ±\x8FÿÛ C \x02\x01\x01\x02\x01\x01\x02\x02\x02\x02\x02\x02\x02\x02\x03\x05\x03\x03\x03\x03\x03\x06\x04\x04\x03\x05\a\x06\a\a\a\x06\a\a\b\t\v\t\b\b\r\n\b\a\a\r\n\r\n\r\n\v\f\f\f\f\a\t\x0E\x0F\r\n\f\x0E\v\f\f\fÿÛ C\x01\x02\x02\x02\x03\x03\x03\x06\x03\x03\x06\f\b\a\b\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\fÿÀ \x11\b \x01 \x01\x03\x01\" \x02\x11\x01\x03\x11\x01ÿÄ \x1F \x01\x05\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x10 \x02\x01\x03\x03\x02\x04\x03\x05\x05\x04\x04 \x01}\x01\x02\x03 \x04\x11\x05\x12!1A\x06\x13Qa\a\"q\x142\x81‘¡\b#B±Á\x15RÑð$3br‚\t\r\n\x16\x17\x18\x19\x1A%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ \x1F\x01 \x03\x01\x01\x01\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x11 \x02\x01\x02\x04\x04\x03\x04\a\x05\x04\x04 \x01\x02w \x01\x02\x03\x11\x04\x05!1\x06\x12AQ\aaq\x13\"2\x81\b\x14B‘¡±Á\t#3Rð\x15brÑ\r\n\x16$4á%ñ\x17\x18\x19\x1A&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚâãäåæçèéêòóôõö÷øùúÿÚ \f\x03\x01 \x02\x11\x03\x11 ? ýü¢Š(\x03ÿÙ" headers: {} '204': description: No more pages. scan done. headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1034 message: This provided job UID is invalid. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} '410': description: The job was deleted. content: application/json: schema: *ref_0 example: code: -1034 message: Invalid Value. statusCode: 410 headers: {} x-200-2: description: '' content: image/png: schema: type: object properties: {} example: "‰PNG\r\n\x1A\r\n \r\nIHDR \x01 \x01\b\x02 \x90wSÞ \x01sRGB ®Î\x1Cé \x04gAMA ±\x8F\vüa\x05 \tpHYs \x0Eà \x0EÃ\x01Ço¨d \fIDAT\x18Wcøÿÿ? \x05þ\x02þ§5\x81„ IEND®B`‚" headers: {} security: [] /storage/documents: post: summary: Create a new document. deprecated: false description: >- The document will be stored in the Dynamic Web TWAIN Service working folder and all the contents will be encrypted. operationId: createDocument tags: - Document Management parameters: [] requestBody: content: application/json: schema: $ref: '#/components/schemas/CreateDocumentOptions' description: password for the document example: '' responses: '201': description: Successful operation content: application/json: schema: &ref_1 description: document info $ref: '#/components/schemas/DocumentInfo' example: uid: 190807444d76 pages: [] headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports POST. statusCode: 405 headers: {} security: [] /storage/documents/{documentuid}: get: summary: Retrieve document info deprecated: false description: Retrieve the document info, including pages info. operationId: getDocumentInfo tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. responses: '200': description: Successful operation content: application/json: schema: *ref_1 example: uid: 190807444d76 pages: - uid: 190817548d70 - uid: '190817648270' headers: {} '400': description: Bad request. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1040 message: The uid does not exist. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET and DELETE. statusCode: 405 headers: {} security: [] delete: summary: Delete the document. deprecated: false description: All the data will be deleted. operationId: deleteDocument tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. responses: '204': description: Successful operation headers: {} '400': description: '' content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: Error resonpse content: application/json: schema: *ref_0 example: code: -1040 message: The uid does not exist. statusCode: 404 headers: {} '405': description: '' content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET and DELETE. statusCode: 405 headers: {} security: [] /storage/documents/{documentuid}/content: get: summary: Retrieve the document content with specified format. deprecated: false description: > Can specify one or more pages with page index or uid, otherwise, the whole document. Also can specify pdf info, and encryption. operationId: getDocContent tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: type in: query description: output mime type required: false schema: type: string enum: - image/jpeg - image/png - image/tiff - application/pdf default: application/pdf description: | Specified the output format. - name: quality in: query description: '' required: false schema: type: integer format: int32 minimum: 1 maximum: 100 default: 80 description: >- range is 0 to 100. only valid for jpeg/jpeg2000 compression. - name: pages in: query description: '' required: false schema: type: string default: '' description: > page indices or uids. multiple values seperated by commas. e.g. pages=5,2,1. If no pages specified, for image/png, image/jpeg, only return first page; for image/tiff, application/pdf, return all pages. - name: author in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: compression in: query description: >- for tiff, please refer to https://www.dynamsoft.com/web-twain/docs/info/api/Dynamsoft_Enum.html#dynamsoftDWTenumDWT_tiffcompressiontype for pdf, please refer to https://www.dynamsoft.com/web-twain/docs/info/api/Dynamsoft_Enum.html#dynamsoftDWTenumDWT_pdfcompressiontype required: false schema: type: integer format: int32 default: 0 description: auto, BW use JBIG2, GrayScale & Color use Jpeg externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: pageType in: query description: '' required: false schema: type: integer format: int32 default: 0 description: page size externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: creator in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: creationDate in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: keyWords in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: modifiedDate in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: producer in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: subject in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: title in: query description: '' required: false schema: type: string default: '' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: version in: query description: '' required: false schema: type: string default: '1.5' externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: password in: query description: '' required: false schema: type: string maxLength: 32 default: '' description: password to encrypt pdf. externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info//api/interfaces.html#pdfwsettings - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. responses: '200': description: Successful operation content: image/jpeg: schema: type: object properties: {} example: "ÿØÿà \x10JFIF \x01\x01\x01 ` ` ÿá ZExif MM * \b \x05\x03\x01 \x05 \x01 J\x03\x03 \x01 \x01 Q\x10 \x01 \x01\x01 Q\x11 \x04 \x01 \x0EÃQ\x12 \x04 \x01 \x0Eà \x01† ±\x8FÿÛ C \x02\x01\x01\x02\x01\x01\x02\x02\x02\x02\x02\x02\x02\x02\x03\x05\x03\x03\x03\x03\x03\x06\x04\x04\x03\x05\a\x06\a\a\a\x06\a\a\b\t\v\t\b\b\r\n\b\a\a\r\n\r\n\r\n\v\f\f\f\f\a\t\x0E\x0F\r\n\f\x0E\v\f\f\fÿÛ C\x01\x02\x02\x02\x03\x03\x03\x06\x03\x03\x06\f\b\a\b\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\f\fÿÀ \x11\b \x01 \x01\x03\x01\" \x02\x11\x01\x03\x11\x01ÿÄ \x1F \x01\x05\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x10 \x02\x01\x03\x03\x02\x04\x03\x05\x05\x04\x04 \x01}\x01\x02\x03 \x04\x11\x05\x12!1A\x06\x13Qa\a\"q\x142\x81‘¡\b#B±Á\x15RÑð$3br‚\t\r\n\x16\x17\x18\x19\x1A%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ \x1F\x01 \x03\x01\x01\x01\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x11 \x02\x01\x02\x04\x04\x03\x04\a\x05\x04\x04 \x01\x02w \x01\x02\x03\x11\x04\x05!1\x06\x12AQ\aaq\x13\"2\x81\b\x14B‘¡±Á\t#3Rð\x15brÑ\r\n\x16$4á%ñ\x17\x18\x19\x1A&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚâãäåæçèéêòóôõö÷øùúÿÚ \f\x03\x01 \x02\x11\x03\x11 ? ýü¢Š(\x03ÿÙ" headers: {} '400': description: '' content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1040 message: The uid does not exist. statusCode: 404 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports GET. statusCode: 405 headers: {} x-200-2: description: Error resonpse content: application/pdf: schema: *ref_0 example: "%PDF-1.5\r\n%¡³Å×\r\n1 0 obj\r\n<>\r\nendobj\r\n2 0 obj\r\n<>\r\nendobj\r\n3 0 obj\r\n<<>>\r\nendobj\r\n4 0 obj\r\n<>/XObject<>>>/Rotate 0/Type/Page>>\r\nendobj\r\n5 0 obj\r\n<>\r\nendobj\r\n6 0 obj\r\n<>stream\r\nÿØÿà \x10JFIF \x01\x01\x01 ` ` ÿÛ C \x06\x04\x05\x06\x05\x04\x06\x06\x05\x06\a\a\x06\b\r\n\x10\r\n\r\n\t\t\r\n\x14\x0E\x0F\f\x10\x17\x14\x18\x18\x17\x14\x16\x16\x1A\x1D%\x1F\x1A\e#\x1C\x16\x16 , #&')*)\x19\x1F-0-(0%()(ÿÛ C\x01\a\a\a\r\n\b\r\n\x13\r\n\r\n\x13(\x1A\x16\x1A((((((((((((((((((((((((((((((((((((((((((((((((((ÿÀ \x11\b \x01 \x01\x03\x01\" \x02\x11\x01\x03\x11\x01ÿÄ \x1F \x01\x05\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x10 \x02\x01\x03\x03\x02\x04\x03\x05\x05\x04\x04 \x01}\x01\x02\x03 \x04\x11\x05\x12!1A\x06\x13Qa\a\"q\x142\x81‘¡\b#B±Á\x15RÑð$3br‚\t\r\n\x16\x17\x18\x19\x1A%&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyzƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚáâãäåæçèéêñòóôõö÷øùúÿÄ \x1F\x01 \x03\x01\x01\x01\x01\x01\x01\x01\x01\x01 \x01\x02\x03\x04\x05\x06\a\b\t\r\n\vÿÄ µ\x11 \x02\x01\x02\x04\x04\x03\x04\a\x05\x04\x04 \x01\x02w \x01\x02\x03\x11\x04\x05!1\x06\x12AQ\aaq\x13\"2\x81\b\x14B‘¡±Á\t#3Rð\x15brÑ\r\n\x16$4á%ñ\x17\x18\x19\x1A&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz‚ƒ„…†‡ˆ‰Š’“”•–—˜™š¢£¤¥¦§¨©ª²³´µ¶·¸¹ºÂÃÄÅÆÇÈÉÊÒÓÔÕÖ×ØÙÚâãäåæçèéêòóôõö÷øùúÿÚ \f\x03\x01 \x02\x11\x03\x11 ? ú¦Š(\_\x0FÿÙ\r\nendstream\r\nendobj\r\n7 0 obj\r\n<>stream\r\nxœ+ä2Ð37U0 A\x18#9—\vÌW(JçÒw‹ˆ0TpÉW\bä\x02 ¹þ\bá\r\nendstream\r\nendobj\r\nxref\r\n0 8\r\n0000000000 65535 f\r\n0000000017 00000 n\r\n0000000066 00000 n\r\n0000000122 00000 n\r\n0000000145 00000 n\r\n0000000331 00000 n\r\n0000000374 00000 n\r\n0000001159 00000 n\r\ntrailer\r\n<<\r\n/Root 1 0 R\r\n/Info 3 0 R\r\n/Size 8\r\n/Tag /Dynamsoft\r\n>>\r\nstartxref\r\n1269\r\n%%EOF\r\n" headers: {} x-200-3: description: '' content: image/png: schema: type: object properties: {} example: "‰PNG\r\n\x1A\r\n \r\nIHDR \x01 \x01\b\x02 \x90wSÞ \x01sRGB ®Î\x1Cé \x04gAMA ±\x8F\vüa\x05 \tpHYs \x0Eà \x0EÃ\x01Ço¨d \fIDAT\x18Wcøÿÿ? \x05þ\x02þ§5\x81„ IEND®B`‚" headers: {} x-200-4: description: '' content: image/tiff: schema: type: object properties: {} example: "II* \x0E €?àP\x10 \x0F þ \x04 \x01 \x01\x04 \x01 \x01 \x01\x01\x04 \x01 \x01 \x02\x01\x03 \x03 È \x03\x01\x03 \x01 \x05 \x06\x01\x03 \x01 \x02 \x11\x01\x04 \x01 \b \x15\x01\x03 \x01 \x03 \x16\x01\x04 \x01 \x01 \x17\x01\x04 \x01 \x05 \x1A\x01\x05 \x01 Î \e\x01\x05 \x01 Ö \x1C\x01\x03 \x01 \x01 (\x01\x03 \x01 \x02 =\x01\x03 \x01 \x02 \b \b \b w\x01 è\x03 w\x01 è\x03 " headers: {} security: [] /storage/documents/{documentuid}/pages: post: summary: Insert new page(s) into an existing document. deprecated: false description: > By default, it will append the pages to the end of document. for multiple tiff, we will split it into multiple images. And for multiple pdf, we will also split it into multiple pages and save raw content. operationId: insertDocPage tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. requestBody: content: application/json: schema: type: object required: - source properties: insertPos: type: number description: > Positive integer. The new page will be inserted before this index. If not set or out of the maximum range, the blank page will be added after the last page. source: oneOf: - type: string example: - >- https://127.0.0.1:18623/api/device/scanners/jobs/dd40716d-48d1-4d32-89f7-1d53f9665d91/next-page?page=19522d0c5282 description: >- Currently only support image url from scan job. eg. "https://127.0.0.1:18623/api/device/scanners/jobs/dd40716d-48d1-4d32-89f7-1d53f9665d91/next-page?page=19522d0c5282" example: '' responses: '200': description: Page inserted successfully content: application/json: schema: *ref_1 example: uid: 190807444d76 pages: - uid: 190817548d70 - uid: 190818458d85 headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1040 message: The uid does not exist. statusCode: 404 headers: {} '405': description: '' content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports POST. statusCode: 405 headers: {} security: [] /storage/documents/{documentuid}/pages/{param}: delete: summary: Delete the specified page. deprecated: false description: Delete the page by uid or page number. operationId: deleteDocPage tags: - Document Management parameters: - name: documentuid in: path description: UID of document required: true example: '' schema: type: string - name: param in: path description: 'UID of the page or page index number (0-based). ' required: true example: '' schema: type: string - name: DWT-DOC-PASSWORD in: header description: the password of document in storage required: false example: '' schema: type: string maxLength: 32 description: cannot exceed 32 chars. responses: '204': description: Page removed successfully headers: {} '400': description: Error resonpse content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: '' content: application/json: schema: *ref_0 example: code: -1043 message: Password invalid. statusCode: 403 headers: {} '404': description: '' content: application/json: schema: *ref_0 example: code: -1040 message: The provided page UID is invalid. statusCode: 404 headers: {} '405': description: '' content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports DELETE. statusCode: 405 headers: {} security: [] /process/{operation}: post: summary: Create a new processing for a specified source. deprecated: false description: > Some operations can be implemented by external modules. Currently, check-blank is Windows only. operationId: createDocProcess tags: - Document Processing parameters: - name: operation in: path description: type of processing required: true example: '' schema: type: string description: > currently only process DWT urls, so we cannot pass index, only has one page. read-barcode can accept a barcode reader template settings. and need to pass extra license with header DWT-PRODUCT-KEY. check-blank can accept null or {minBlockHeight?: number, maxBlockHeight?: number}. rotate can accept {rotation: number, keepSize?: boolean}. calculate-skew-angle can accept null. enum: - check-blank - read-barcode - name: DWT-PRODUCT-KEY in: header description: the license for image processing required: false example: '' schema: type: string requestBody: content: application/json: schema: description: different processings have different parameters. $ref: '#/components/schemas/CreateProcessOptions' example: '' responses: '200': description: Successful operation content: application/json: schema: type: object properties: result: type: boolean description: is blank image or not required: - result example: result: true headers: {} '400': description: Bad request. e.g. parameter is invalid. content: application/json: schema: *ref_0 example: code: -2113 message: The parameter is not valid. statusCode: 400 headers: {} '403': description: License is invalid. content: application/json: schema: *ref_0 example: code: -2800 message: >- The current product key is empty or invalid, please contact the site administrator. statusCode: 403 headers: {} '405': description: Method not allowed content: application/json: schema: *ref_0 example: code: -2112 message: This endpoint only supports POST. statusCode: 405 headers: {} x-200-2: description: '' content: application/json: schema: type: object properties: {} description: barcode result example: - BarcodeFormat: 2 BarcodeFormatString: CODE_128 LocalizationResult: ResultPoints: - 723, 274 - 1021, 275 - 1021, 375 - 723, 374 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 2 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 723 x2: 1021 x3: 1021 x4: 723 y1: 274 y2: 275 y3: 375 y4: 374 barcodeBytes: - 67 - 79 - 68 - 69 - 49 - 50 - 56 barcodeFormat: 2 barcodeFormatString: CODE_128 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: CODE128 detailedResult: checkDigitBytes: [] moduleSize: 2 startCharsBytes: [] stopCharsBytes: [] localizationResult: ResultPoints: - 723, 274 - 1021, 275 - 1021, 375 - 723, 374 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 2 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 723 x2: 1021 x3: 1021 x4: 723 y1: 274 y2: 275 y3: 375 y4: 374 results: - accompanyingTextBytes: [] barcodeFormat: 2 barcodeFormatString: CODE_128 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 67 - 79 - 68 - 69 - 49 - 50 - 56 clarity: -1 confidence: 100 deformation: 0 resultType: 0 - BarcodeFormat: 4 BarcodeFormatString: CODE_93 LocalizationResult: ResultPoints: - 183, 652 - 551, 652 - 551, 768 - 183, 768 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 183 x2: 551 x3: 551 x4: 183 y1: 652 y2: 652 y3: 768 y4: 768 barcodeBytes: - 67 - 79 - 68 - 69 - 57 - 51 barcodeFormat: 4 barcodeFormatString: CODE_93 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: CODE93 detailedResult: checkDigitBytes: [] moduleSize: 4 startCharsBytes: - 42 stopCharsBytes: - 42 localizationResult: ResultPoints: - 183, 652 - 551, 652 - 551, 768 - 183, 768 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 183 x2: 551 x3: 551 x4: 183 y1: 652 y2: 652 y3: 768 y4: 768 results: - accompanyingTextBytes: [] barcodeFormat: 4 barcodeFormatString: CODE_93 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 67 - 79 - 68 - 69 - 57 - 51 clarity: -1 confidence: 100 deformation: 0 resultType: 0 - BarcodeFormat: 131072 BarcodeFormatString: GS1 Databar Limited LocalizationResult: ResultPoints: - 1348, 663 - 1545, 663 - 1545, 797 - 1348, 797 accompanyingTextBytes: [] angle: 0 barcodeFormat: 131072 barcodeFormatString: GS1 Databar Limited barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1348 x2: 1545 x3: 1545 x4: 1348 y1: 663 y2: 663 y3: 797 y4: 797 barcodeBytes: - 48 - 48 - 48 - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 53 barcodeFormat: 131072 barcodeFormatString: GS1 Databar Limited barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '00001234567895' detailedResult: null localizationResult: ResultPoints: - 1348, 663 - 1545, 663 - 1545, 797 - 1348, 797 accompanyingTextBytes: [] angle: 0 barcodeFormat: 131072 barcodeFormatString: GS1 Databar Limited barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1348 x2: 1545 x3: 1545 x4: 1348 y1: 663 y2: 663 y3: 797 y4: 797 results: - accompanyingTextBytes: [] barcodeFormat: 131072 barcodeFormatString: GS1 Databar Limited barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 48 - 48 - 48 - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 53 clarity: -1 confidence: 100 deformation: 0 resultType: 0 - BarcodeFormat: 268435456 BarcodeFormatString: AZTEC LocalizationResult: ResultPoints: - 777, 1354 - 888, 1354 - 888, 1465 - 777, 1465 accompanyingTextBytes: [] angle: 0 barcodeFormat: 268435456 barcodeFormatString: AZTEC barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 8 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 777 x2: 888 x3: 888 x4: 777 y1: 1354 y2: 1354 y3: 1465 y4: 1465 barcodeBytes: - 68 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 barcodeFormat: 268435456 barcodeFormatString: AZTEC barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: Dynamsoft detailedResult: columns: 15 layerNumber: -1 moduleSize: 8 rows: 15 localizationResult: ResultPoints: - 777, 1354 - 888, 1354 - 888, 1465 - 777, 1465 accompanyingTextBytes: [] angle: 0 barcodeFormat: 268435456 barcodeFormatString: AZTEC barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 100 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 8 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 777 x2: 888 x3: 888 x4: 777 y1: 1354 y2: 1354 y3: 1465 y4: 1465 results: - accompanyingTextBytes: [] barcodeFormat: 268435456 barcodeFormatString: AZTEC barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 68 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 clarity: -1 confidence: 100 deformation: 0 resultType: 0 - accompanyingTextBytes: [] barcodeFormat: 268435456 barcodeFormatString: AZTEC barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 68 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 clarity: -1 confidence: 100 deformation: 0 resultType: 1 - BarcodeFormat: 134217728 BarcodeFormatString: DATAMATRIX LocalizationResult: ResultPoints: - 1074, 1346 - 1229, 1346 - 1229, 1502 - 1074, 1502 accompanyingTextBytes: [] angle: 0 barcodeFormat: 134217728 barcodeFormatString: DATAMATRIX barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 98 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 9 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1074 x2: 1229 x3: 1229 x4: 1074 y1: 1346 y2: 1346 y3: 1502 y4: 1502 barcodeBytes: - 119 - 119 - 119 - 46 - 100 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 46 - 99 - 111 - 109 barcodeFormat: 134217728 barcodeFormatString: DATAMATRIX barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: www.dynamsoft.com detailedResult: columns: 18 dataRegionColumns: 16 dataRegionNumber: 1 dataRegionRows: 16 moduleSize: 9 rows: 18 localizationResult: ResultPoints: - 1074, 1346 - 1229, 1346 - 1229, 1502 - 1074, 1502 accompanyingTextBytes: [] angle: 0 barcodeFormat: 134217728 barcodeFormatString: DATAMATRIX barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 98 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 9 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1074 x2: 1229 x3: 1229 x4: 1074 y1: 1346 y2: 1346 y3: 1502 y4: 1502 results: - accompanyingTextBytes: [] barcodeFormat: 134217728 barcodeFormatString: DATAMATRIX barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 119 - 119 - 119 - 46 - 100 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 46 - 99 - 111 - 109 clarity: -1 confidence: 98 deformation: 0 resultType: 0 - BarcodeFormat: 0 BarcodeFormatString: USPS Intelligent Mail LocalizationResult: ResultPoints: - 1753, 1380 - 2397, 1381 - 2397, 1480 - 1753, 1479 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: USPS Intelligent Mail barcodeFormatString_2: USPS Intelligent Mail barcodeFormat_2: 1048576 confidence: 96 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 5 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1753 x2: 2397 x3: 2397 x4: 1753 y1: 1380 y2: 1381 y3: 1480 y4: 1479 barcodeBytes: - 52 - 52 - 49 - 50 - 51 - 49 - 50 - 51 - 52 - 53 - 54 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 barcodeFormat: 0 barcodeFormatString: USPS Intelligent Mail barcodeFormatString_2: USPS Intelligent Mail barcodeFormat_2: 1048576 barcodeText: '44123123456123456789' detailedResult: null localizationResult: ResultPoints: - 1753, 1380 - 2397, 1381 - 2397, 1480 - 1753, 1479 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: USPS Intelligent Mail barcodeFormatString_2: USPS Intelligent Mail barcodeFormat_2: 1048576 confidence: 96 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 5 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1753 x2: 2397 x3: 2397 x4: 1753 y1: 1380 y2: 1381 y3: 1480 y4: 1479 results: - accompanyingTextBytes: [] barcodeFormat: 0 barcodeFormatString: USPS Intelligent Mail barcodeFormatString_2: USPS Intelligent Mail barcodeFormat_2: 1048576 bytes: - 52 - 52 - 49 - 50 - 51 - 49 - 50 - 51 - 52 - 53 - 54 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 clarity: -1 confidence: 96 deformation: 0 resultType: 0 - BarcodeFormat: 0 BarcodeFormatString: Australian Post LocalizationResult: ResultPoints: - 1838, 282 - 2294, 282 - 2294, 346 - 1838, 346 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Australian Post barcodeFormatString_2: Australian Post barcodeFormat_2: 8388608 confidence: 95 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1838 x2: 2294 x3: 2294 x4: 1838 y1: 282 y2: 282 y3: 346 y4: 346 barcodeBytes: - 49 - 49 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 50 - 54 - 52 - 52 - 49 - 57 - 49 - 53 barcodeFormat: 0 barcodeFormatString: Australian Post barcodeFormatString_2: Australian Post barcodeFormat_2: 8388608 barcodeText: 11,12345678,26 44 19 15 detailedResult: null localizationResult: ResultPoints: - 1838, 282 - 2294, 282 - 2294, 346 - 1838, 346 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Australian Post barcodeFormatString_2: Australian Post barcodeFormat_2: 8388608 confidence: 95 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1838 x2: 2294 x3: 2294 x4: 1838 y1: 282 y2: 282 y3: 346 y4: 346 results: - accompanyingTextBytes: [] barcodeFormat: 0 barcodeFormatString: Australian Post barcodeFormatString_2: Australian Post barcodeFormat_2: 8388608 bytes: - 49 - 49 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 50 - 54 - 52 - 52 - 49 - 57 - 49 - 53 clarity: -1 confidence: 95 deformation: 0 resultType: 0 - BarcodeFormat: 0 BarcodeFormatString: Postnet LocalizationResult: ResultPoints: - 1699, 1067 - 2467, 1067 - 2467, 1106 - 1699, 1106 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Postnet barcodeFormatString_2: Postnet barcodeFormat_2: 2097152 confidence: 93 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1699 x2: 2467 x3: 2467 x4: 1699 y1: 1067 y2: 1067 y3: 1106 y4: 1106 barcodeBytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 49 - 52 barcodeFormat: 0 barcodeFormatString: Postnet barcodeFormatString_2: Postnet barcodeFormat_2: 2097152 barcodeText: '123456789014' detailedResult: null localizationResult: ResultPoints: - 1699, 1067 - 2467, 1067 - 2467, 1106 - 1699, 1106 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Postnet barcodeFormatString_2: Postnet barcodeFormat_2: 2097152 confidence: 93 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1699 x2: 2467 x3: 2467 x4: 1699 y1: 1067 y2: 1067 y3: 1106 y4: 1106 results: - accompanyingTextBytes: [] barcodeFormat: 0 barcodeFormatString: Postnet barcodeFormatString_2: Postnet barcodeFormat_2: 2097152 bytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 49 - 52 clarity: -1 confidence: 93 deformation: 0 resultType: 0 - BarcodeFormat: 0 BarcodeFormatString: Royal Mail 4-State Customer Barcode LocalizationResult: ResultPoints: - 1799, 554 - 2367, 554 - 2367, 618 - 1799, 618 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Royal Mail 4-State Customer Barcode barcodeFormatString_2: Royal Mail 4-State Customer Barcode barcodeFormat_2: 16777216 confidence: 92 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1799 x2: 2367 x3: 2367 x4: 1799 y1: 554 y2: 554 y3: 618 y4: 618 barcodeBytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 65 - 66 - 67 barcodeFormat: 0 barcodeFormatString: Royal Mail 4-State Customer Barcode barcodeFormatString_2: Royal Mail 4-State Customer Barcode barcodeFormat_2: 16777216 barcodeText: 1234567ABC detailedResult: null localizationResult: ResultPoints: - 1799, 554 - 2367, 554 - 2367, 618 - 1799, 618 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Royal Mail 4-State Customer Barcode barcodeFormatString_2: Royal Mail 4-State Customer Barcode barcodeFormat_2: 16777216 confidence: 92 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1799 x2: 2367 x3: 2367 x4: 1799 y1: 554 y2: 554 y3: 618 y4: 618 results: - accompanyingTextBytes: [] barcodeFormat: 0 barcodeFormatString: Royal Mail 4-State Customer Barcode barcodeFormatString_2: Royal Mail 4-State Customer Barcode barcodeFormat_2: 16777216 bytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 65 - 66 - 67 clarity: -1 confidence: 92 deformation: 0 resultType: 0 - BarcodeFormat: 0 BarcodeFormatString: Planet LocalizationResult: ResultPoints: - 1696, 814 - 2464, 814 - 2464, 853 - 1696, 853 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Planet barcodeFormatString_2: Planet barcodeFormat_2: 4194304 confidence: 92 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1696 x2: 2464 x3: 2464 x4: 1696 y1: 814 y2: 814 y3: 853 y4: 853 barcodeBytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 49 - 52 barcodeFormat: 0 barcodeFormatString: Planet barcodeFormatString_2: Planet barcodeFormat_2: 4194304 barcodeText: '123456789014' detailedResult: null localizationResult: ResultPoints: - 1696, 814 - 2464, 814 - 2464, 853 - 1696, 853 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: Planet barcodeFormatString_2: Planet barcodeFormat_2: 4194304 confidence: 92 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1696 x2: 2464 x3: 2464 x4: 1696 y1: 814 y2: 814 y3: 853 y4: 853 results: - accompanyingTextBytes: [] barcodeFormat: 0 barcodeFormatString: Planet barcodeFormatString_2: Planet barcodeFormat_2: 4194304 bytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 49 - 52 clarity: -1 confidence: 92 deformation: 0 resultType: 0 - BarcodeFormat: 16384 BarcodeFormatString: GS1 Databar Stacked Omnidirectional LocalizationResult: ResultPoints: - 1382, 318 - 1578, 318 - 1570, 515 - 1377, 515 accompanyingTextBytes: [] angle: 180 barcodeFormat: 16384 barcodeFormatString: GS1 Databar Stacked Omnidirectional barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 90 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1382 x2: 1578 x3: 1570 x4: 1377 y1: 318 y2: 318 y3: 515 y4: 515 barcodeBytes: - 48 - 49 - 50 - 51 - 48 - 52 - 53 - 54 - 48 - 55 - 56 - 57 - 48 - 53 barcodeFormat: 16384 barcodeFormatString: GS1 Databar Stacked Omnidirectional barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '01230456078905' detailedResult: null localizationResult: ResultPoints: - 1382, 318 - 1578, 318 - 1570, 515 - 1377, 515 accompanyingTextBytes: [] angle: 180 barcodeFormat: 16384 barcodeFormatString: GS1 Databar Stacked Omnidirectional barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 90 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1382 x2: 1578 x3: 1570 x4: 1377 y1: 318 y2: 318 y3: 515 y4: 515 results: - accompanyingTextBytes: [] barcodeFormat: 16384 barcodeFormatString: GS1 Databar Stacked Omnidirectional barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 48 - 49 - 50 - 51 - 48 - 52 - 53 - 54 - 48 - 55 - 56 - 57 - 48 - 53 clarity: -1 confidence: 90 deformation: 0 resultType: 0 - BarcodeFormat: 33554432 BarcodeFormatString: PDF417 LocalizationResult: ResultPoints: - 153, 1346 - 605, 1346 - 605, 1486 - 153, 1486 accompanyingTextBytes: [] angle: 0 barcodeFormat: 33554432 barcodeFormatString: PDF417 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 88 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 153 x2: 605 x3: 605 x4: 153 y1: 1346 y2: 1346 y3: 1486 y4: 1486 barcodeBytes: - 119 - 119 - 119 - 46 - 100 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 46 - 99 - 111 - 109 barcodeFormat: 33554432 barcodeFormatString: PDF417 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: www.dynamsoft.com detailedResult: columns: 3 errorCorrectionLevel: 2 moduleSize: 4 rows: 7 localizationResult: ResultPoints: - 153, 1346 - 605, 1346 - 605, 1486 - 153, 1486 accompanyingTextBytes: [] angle: 0 barcodeFormat: 33554432 barcodeFormatString: PDF417 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 88 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 153 x2: 605 x3: 605 x4: 153 y1: 1346 y2: 1346 y3: 1486 y4: 1486 results: - accompanyingTextBytes: [] barcodeFormat: 33554432 barcodeFormatString: PDF417 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 119 - 119 - 119 - 46 - 100 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 46 - 99 - 111 - 109 clarity: -1 confidence: 88 deformation: 0 resultType: 0 - accompanyingTextBytes: [] barcodeFormat: 33554432 barcodeFormatString: PDF417 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 119 - 119 - 119 - 46 - 100 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 46 - 99 - 111 - 109 clarity: -1 confidence: 88 deformation: 0 resultType: 1 - BarcodeFormat: 67108864 BarcodeFormatString: QR_CODE LocalizationResult: ResultPoints: - 838, 1094 - 989, 1094 - 988, 1244 - 839, 1244 accompanyingTextBytes: [] angle: 0 barcodeFormat: 67108864 barcodeFormatString: QR_CODE barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 86 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 838 x2: 989 x3: 988 x4: 839 y1: 1094 y2: 1094 y3: 1244 y4: 1244 barcodeBytes: - 119 - 119 - 119 - 46 - 100 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 46 - 99 - 111 - 109 barcodeFormat: 67108864 barcodeFormatString: QR_CODE barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: www.dynamsoft.com detailedResult: columns: 25 errorCorrectionLevel: 2 model: 2 moduleSize: 6 rows: 25 version: 2 localizationResult: ResultPoints: - 838, 1094 - 989, 1094 - 988, 1244 - 839, 1244 accompanyingTextBytes: [] angle: 0 barcodeFormat: 67108864 barcodeFormatString: QR_CODE barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 86 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 6 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 838 x2: 989 x3: 988 x4: 839 y1: 1094 y2: 1094 y3: 1244 y4: 1244 results: - accompanyingTextBytes: [] barcodeFormat: 67108864 barcodeFormatString: QR_CODE barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 119 - 119 - 119 - 46 - 100 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 46 - 99 - 111 - 109 clarity: -1 confidence: 86 deformation: 0 resultType: 0 - BarcodeFormat: 32 BarcodeFormatString: EAN_13 LocalizationResult: ResultPoints: - 177, 876 - 462, 876 - 462, 976 - 177, 976 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 85 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 2 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 177 x2: 462 x3: 462 x4: 177 y1: 876 y2: 876 y3: 976 y4: 976 barcodeBytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 49 - 50 - 56 barcodeFormat: 32 barcodeFormatString: EAN_13 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '1234567890128' detailedResult: checkDigitBytes: [] moduleSize: 2 startCharsBytes: [] stopCharsBytes: [] localizationResult: ResultPoints: - 177, 876 - 462, 876 - 462, 976 - 177, 976 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 85 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 2 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 177 x2: 462 x3: 462 x4: 177 y1: 876 y2: 876 y3: 976 y4: 976 results: - accompanyingTextBytes: [] barcodeFormat: 32 barcodeFormatString: EAN_13 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 49 - 50 - 56 clarity: -1 confidence: 85 deformation: 0 resultType: 0 - BarcodeFormat: 0 BarcodeFormatString: DotCode LocalizationResult: ResultPoints: - 886, 897 - 1018, 897 - 1018, 985 - 886, 985 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: DotCode barcodeFormatString_2: DotCode barcodeFormat_2: 2 confidence: 82 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 886 x2: 1018 x3: 1018 x4: 886 y1: 897 y2: 897 y3: 985 y4: 985 barcodeBytes: - 68 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 32 - 66 - 97 - 114 - 99 - 111 - 100 - 101 - 32 - 82 - 101 - 97 - 100 - 101 - 114 barcodeFormat: 0 barcodeFormatString: DotCode barcodeFormatString_2: DotCode barcodeFormat_2: 2 barcodeText: Dynamsoft Barcode Reader detailedResult: null localizationResult: ResultPoints: - 886, 897 - 1018, 897 - 1018, 985 - 886, 985 accompanyingTextBytes: [] angle: 0 barcodeFormat: 0 barcodeFormatString: DotCode barcodeFormatString_2: DotCode barcodeFormat_2: 2 confidence: 82 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 4 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 886 x2: 1018 x3: 1018 x4: 886 y1: 897 y2: 897 y3: 985 y4: 985 results: - accompanyingTextBytes: [] barcodeFormat: 0 barcodeFormatString: DotCode barcodeFormatString_2: DotCode barcodeFormat_2: 2 bytes: - 68 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 - 32 - 66 - 97 - 114 - 99 - 111 - 100 - 101 - 32 - 82 - 101 - 97 - 100 - 101 - 114 clarity: -1 confidence: 82 deformation: 0 resultType: 0 - BarcodeFormat: 536870912 BarcodeFormatString: Maxicode LocalizationResult: ResultPoints: - 1396, 1327 - 1595, 1327 - 1595, 1525 - 1396, 1525 accompanyingTextBytes: [] angle: 0 barcodeFormat: 536870912 barcodeFormatString: Maxicode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 81 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 7 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1396 x2: 1595 x3: 1595 x4: 1396 y1: 1327 y2: 1327 y3: 1525 y4: 1525 barcodeBytes: - 77 - 97 - 120 - 105 - 99 - 111 - 100 - 101 - 32 - 102 - 114 - 111 - 109 - 32 - 68 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 barcodeFormat: 536870912 barcodeFormatString: Maxicode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: Maxicode from Dynamsoft detailedResult: null localizationResult: ResultPoints: - 1396, 1327 - 1595, 1327 - 1595, 1525 - 1396, 1525 accompanyingTextBytes: [] angle: 0 barcodeFormat: 536870912 barcodeFormatString: Maxicode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 81 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 7 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 1396 x2: 1595 x3: 1595 x4: 1396 y1: 1327 y2: 1327 y3: 1525 y4: 1525 results: - accompanyingTextBytes: [] barcodeFormat: 536870912 barcodeFormatString: Maxicode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 77 - 97 - 120 - 105 - 99 - 111 - 100 - 101 - 32 - 102 - 114 - 111 - 109 - 32 - 68 - 121 - 110 - 97 - 109 - 115 - 111 - 102 - 116 clarity: -1 confidence: 81 deformation: 0 resultType: 0 - BarcodeFormat: 512 BarcodeFormatString: INDUSTRIAL_25 LocalizationResult: ResultPoints: - 157, 1109 - 672, 1109 - 672, 1229 - 157, 1229 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 70 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 5 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 157 x2: 672 x3: 672 x4: 157 y1: 1109 y2: 1109 y3: 1229 y4: 1229 barcodeBytes: - 49 - 50 - 51 - 52 - 53 - 54 barcodeFormat: 512 barcodeFormatString: INDUSTRIAL_25 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '123456' detailedResult: checkDigitBytes: [] moduleSize: 5 startCharsBytes: [] stopCharsBytes: [] localizationResult: ResultPoints: - 157, 1109 - 672, 1109 - 672, 1229 - 157, 1229 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 70 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 5 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 157 x2: 672 x3: 672 x4: 157 y1: 1109 y2: 1109 y3: 1229 y4: 1229 results: - accompanyingTextBytes: [] barcodeFormat: 512 barcodeFormatString: INDUSTRIAL_25 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 49 - 50 - 51 - 52 - 53 - 54 clarity: -1 confidence: 70 deformation: 0 resultType: 0 - BarcodeFormat: 16 BarcodeFormatString: ITF LocalizationResult: ResultPoints: - 935, 469 - 1233, 469 - 1233, 565 - 935, 565 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 68 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 935 x2: 1233 x3: 1233 x4: 935 y1: 469 y2: 469 y3: 565 y4: 565 barcodeBytes: - 48 - 48 - 49 - 50 - 51 - 52 - 53 - 54 barcodeFormat: 16 barcodeFormatString: ITF barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '00123456' detailedResult: checkDigitBytes: [] moduleSize: 3 startCharsBytes: [] stopCharsBytes: [] localizationResult: ResultPoints: - 935, 469 - 1233, 469 - 1233, 565 - 935, 565 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 68 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 935 x2: 1233 x3: 1233 x4: 935 y1: 469 y2: 469 y3: 565 y4: 565 results: - accompanyingTextBytes: [] barcodeFormat: 16 barcodeFormatString: ITF barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 48 - 48 - 49 - 50 - 51 - 52 - 53 - 54 clarity: -1 confidence: 68 deformation: 0 resultType: 0 - BarcodeFormat: 128 BarcodeFormatString: UPC_A LocalizationResult: ResultPoints: - 752, 649 - 1061, 649 - 1061, 767 - 752, 767 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 61 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 752 x2: 1061 x3: 1061 x4: 752 y1: 649 y2: 649 y3: 767 y4: 767 barcodeBytes: - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 53 barcodeFormat: 128 barcodeFormatString: UPC_A barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '012345678905' detailedResult: checkDigitBytes: [] moduleSize: 3 startCharsBytes: [] stopCharsBytes: [] localizationResult: ResultPoints: - 752, 649 - 1061, 649 - 1061, 767 - 752, 767 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 61 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 752 x2: 1061 x3: 1061 x4: 752 y1: 649 y2: 649 y3: 767 y4: 767 results: - accompanyingTextBytes: [] barcodeFormat: 128 barcodeFormatString: UPC_A barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 48 - 53 clarity: -1 confidence: 61 deformation: 0 resultType: 0 - BarcodeFormat: 8 BarcodeFormatString: CODABAR LocalizationResult: ResultPoints: - 183, 465 - 478, 464 - 478, 560 - 183, 559 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 59 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 2 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 183 x2: 478 x3: 478 x4: 183 y1: 465 y2: 464 y3: 560 y4: 559 barcodeBytes: - 48 - 49 - 50 - 51 - 52 - 53 barcodeFormat: 8 barcodeFormatString: CODABAR barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '012345' detailedResult: checkDigitBytes: [] moduleSize: 2 startCharsBytes: - 67 stopCharsBytes: - 68 localizationResult: ResultPoints: - 183, 465 - 478, 464 - 478, 560 - 183, 559 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 59 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 2 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 183 x2: 478 x3: 478 x4: 183 y1: 465 y2: 464 y3: 560 y4: 559 results: - accompanyingTextBytes: [] barcodeFormat: 8 barcodeFormatString: CODABAR barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 48 - 49 - 50 - 51 - 52 - 53 clarity: -1 confidence: 59 deformation: 0 resultType: 0 - BarcodeFormat: 1024 BarcodeFormatString: CODE_39_EXTENDED LocalizationResult: ResultPoints: - 183, 272 - 564, 273 - 564, 373 - 183, 372 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 57 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 183 x2: 564 x3: 564 x4: 183 y1: 272 y2: 273 y3: 373 y4: 372 barcodeBytes: - 67 - 79 - 68 - 69 - 51 - 57 barcodeFormat: 1024 barcodeFormatString: CODE_39_EXTENDED barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: CODE39 detailedResult: checkDigitBytes: [] moduleSize: 3 startCharsBytes: - 42 stopCharsBytes: - 42 localizationResult: ResultPoints: - 183, 272 - 564, 273 - 564, 373 - 183, 372 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 57 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 183 x2: 564 x3: 564 x4: 183 y1: 272 y2: 273 y3: 373 y4: 372 results: - accompanyingTextBytes: [] barcodeFormat: 1024 barcodeFormatString: CODE_39_EXTENDED barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 67 - 79 - 68 - 69 - 51 - 57 clarity: -1 confidence: 57 deformation: 0 resultType: 0 - BarcodeFormat: 64 BarcodeFormatString: EAN_8 LocalizationResult: ResultPoints: - 579, 467 - 780, 467 - 780, 549 - 579, 549 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 56 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 579 x2: 780 x3: 780 x4: 579 y1: 467 y2: 467 y3: 549 y4: 549 barcodeBytes: - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 53 barcodeFormat: 64 barcodeFormatString: EAN_8 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '01234565' detailedResult: checkDigitBytes: [] moduleSize: 3 startCharsBytes: [] stopCharsBytes: [] localizationResult: ResultPoints: - 579, 467 - 780, 467 - 780, 549 - 579, 549 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 56 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 579 x2: 780 x3: 780 x4: 579 y1: 467 y2: 467 y3: 549 y4: 549 results: - accompanyingTextBytes: [] barcodeFormat: 64 barcodeFormatString: EAN_8 barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 53 clarity: -1 confidence: 56 deformation: 0 resultType: 0 - BarcodeFormat: 262144 BarcodeFormatString: PatchCode LocalizationResult: ResultPoints: - 0, 0 - 2641, 0 - 2641, 1721 - 0, 1721 accompanyingTextBytes: [] angle: 0 barcodeFormat: 262144 barcodeFormatString: PatchCode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 41 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 7 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 0 x2: 2641 x3: 2641 x4: 0 y1: 0 y2: 0 y3: 1721 y4: 1721 barcodeBytes: - 80 - 97 - 116 - 99 - 104 - 32 - 50 barcodeFormat: 262144 barcodeFormatString: PatchCode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: Patch 2 detailedResult: null localizationResult: ResultPoints: - 0, 0 - 2641, 0 - 2641, 1721 - 0, 1721 accompanyingTextBytes: [] angle: 0 barcodeFormat: 262144 barcodeFormatString: PatchCode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 41 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 7 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 0 x2: 2641 x3: 2641 x4: 0 y1: 0 y2: 0 y3: 1721 y4: 1721 results: - accompanyingTextBytes: [] barcodeFormat: 262144 barcodeFormatString: PatchCode barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 80 - 97 - 116 - 99 - 104 - 32 - 50 clarity: -1 confidence: 41 deformation: 0 resultType: 0 - BarcodeFormat: 256 BarcodeFormatString: UPC_E LocalizationResult: ResultPoints: - 613, 892 - 767, 892 - 766, 974 - 613, 974 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 31 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 613 x2: 767 x3: 766 x4: 613 y1: 892 y2: 892 y3: 974 y4: 974 barcodeBytes: - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 53 barcodeFormat: 256 barcodeFormatString: UPC_E barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 barcodeText: '01234565' detailedResult: checkDigitBytes: [] moduleSize: 3 startCharsBytes: [] stopCharsBytes: [] localizationResult: ResultPoints: - 613, 892 - 767, 892 - 766, 974 - 613, 974 accompanyingTextBytes: [] angle: 0 barcodeFormat: 3147775 barcodeFormatString: OneD barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 confidence: 31 documentName: '{B683937D-B327-4488-A2C0-499760CB6BF0}' moduleSize: 3 pageNumber: 1 regionName: '' resultCoordinateType: 1 terminatePhase: 32 x1: 613 x2: 767 x3: 766 x4: 613 y1: 892 y2: 892 y3: 974 y4: 974 results: - accompanyingTextBytes: [] barcodeFormat: 256 barcodeFormatString: UPC_E barcodeFormatString_2: No Barcode Format in group 2 barcodeFormat_2: 0 bytes: - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 53 clarity: -1 confidence: 31 deformation: 0 resultType: 0 headers: {} security: [] components: schemas: Error: type: object required: - statusCode - code - message properties: statusCode: type: number description: >- http status code, 401 is authentication error (missing auth, or auth is invalid), 403 is license error or no access, e.g. non-admin want to access admin resource code: type: number format: int32 description: error code in server, Usually is 0 or a negative number. message: type: string cause: type: object description: optional, if exits, it show the system error code and message. properties: code: type: number format: int32 description: system error code. message: type: string description: system error string of the code. example: - cause: code: 3 message: The system cannot find the path specified. code: -2113 message: The parameter is not valid. statusCode: 400 ScanDocumentInfo: type: object description: | Not all info is same with documentation, e.g. image url, image uid externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Interfaces.html#outputinfo properties: {} example: - extendedImageInfo: {} imageId: 1 imageInfo: BitsPerPixel: 24 BitsPerSample: - 8 - 8 - 8 - 0 - 0 - 0 - 0 - 0 Compression: 0 ImageLayout: DocumentNumber: 1 Frame: Bottom: 11 Left: 0 Right: 8.5 Top: 0 FrameNumber: 0 PageNumber: 1 ImageLength: 2200 ImageWidth: 1700 PixelType: 2 Planar: false SamplesPerPixel: 3 XResolution: 200 YResolution: 200 imageuid: 1951d65a72b1 url: >- https://127.0.0.1:18623/api/device/scanners/jobs/510dadf2-7e29-4172-80f1-49fa5d2ea0bf/next-page?page=1951d65a72b1 ScannerType: externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Dynamsoft_Enum.html#dynamsoftDWTenumDWT_devicetype type: integer format: int32 description: | one or a combination of: * 0x10 TWAINSCANNER * 0x20 WIASCANNER * 0x40 TWAINX64SCANNER * 0x80 ICASCANNER * 0x100 SANESCANNER * 0x200 ESCLSCANNER * 0x400 WIFIDIRECTSCANNER * 0x800 WIATWAINSCANNER example: - 16 Scanner: type: object description: | We also return websocket protocol info. but not list. properties: name: type: string description: Scanner name example: - TWAIN2 FreeImage Software Scanner type: *ref_2 device: type: string description: A json string of the scanner details. example: - >- {"deviceInfo":{"Manufacturer":"VFdBSU4gV29ya2luZyBHcm91cA==","ProductFamily":"U29mdHdhcmUgU2Nhbg==","ProductName":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy","ProtocolMajor":2,"ProtocolMinor":1,"SupportedGroups":0,"Version":{"Country":1,"Info":"Mi4xLjMgc2FtcGxlIHJlbGVhc2UgMzJiaXQ=","Language":2,"MajorNum":2,"MinorNum":1}},"deviceType":16,"isSystemDefaultPrinter":false,"name":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy"} required: - name - type - device CreateScanJobOptions: type: object properties: autoRun: type: boolean default: true description: >- If true, will run the job at once after created. otherwise the job will be created but not run, status is pending, and the scanner will be locked, if the scanner is a twain source, the source will be opened automatically. Recommend to set it as false, avoid your papers may be scanned by others. requestFocusForScanningUI: type: boolean default: true description: >- If true, the scanner UI will be brought to the top and get focus. scannerFailureTimeout: type: integer format: int32 default: 15 description: >- time out for communication with scanner. unit is second. default is 15. We have a default 15 seconds for twain scanner open. Twain scanner will report error when failed to open source, or paper jammed. If you are not near the scanner, recommend to set a suitable time. We will start timer when open source, set capability/settings, acquire, and when we received a page, we will restart the timer. jobTimeout: type: integer format: int32 default: 0 description: >- time out for the scan job. unit is second. default is 0, never timeout. If you create a pending job, the scanner will be locked auto, you can release the scanner through delete the job or set a job timeout. We will start timer after pending job was created, but when the job is running, we will stop the timer. After the job was done (completed or canceled or fault), we will restart the timer if you set. device: type: string description: same to scanner returned, in Device.device config: type: object description: > property apply order is settings -> caps -> config Add a CheckFeederLoaded property to check if the feeder is loaded. externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Interfaces.html#DeviceConfiguration properties: {} caps: type: object description: scanner capability setting externalDocs: url: >- https://www.dynamsoft.com/web-twain/docs/info/api/Interfaces.html#capabilities properties: {} settings: type: string description: > If caps and settings exist at the same time, we will apply settings first, then caps. It is only for twain scanner. We can get the settings via /device/scanners/jobs/{jobuid}/scanner/settings checkFeederLoaded: type: boolean description: >- for TWAIN driver, if scan with feeder, set it as true, we will try to detect the feeder is loaded, if the driver is supported, it can work, otherwise it may be not right. (ICA not sure) default: false example: - autoRun: false device: >- {"deviceInfo":{"Manufacturer":"VFdBSU4gV29ya2luZyBHcm91cA==","ProductFamily":"U29mdHdhcmUgU2Nhbg==","ProductName":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy","ProtocolMajor":2,"ProtocolMinor":1,"SupportedGroups":0,"Version":{"Country":1,"Info":"Mi4xLjMgc2FtcGxlIHJlbGVhc2UgMzJiaXQ=","Language":2,"MajorNum":2,"MinorNum":1}},"deviceType":16,"isSystemDefaultPrinter":false,"name":"VFdBSU4yIEZyZWVJbWFnZSBTb2Z0d2FyZSBTY2FubmVy"} name: TWAIN2 FreeImage Software Scanner checkFeederLoaded: true config: PixelType: 1 Resolution: 300 IfFeederEnabled: true IfDuplexEnabled: false IfGetImageInfo: true IfGetExtImageInfo: true extendedImageInfoQueryLevel: 0 IfCloseSourceAfterAcquire: true XferCount: 11 caps: exception: ignore capabilities: - capability: 4355 curValue: 500 settings: >- Rfj6pIMTNkCu3BfDloGItBAAAAACEAAABgAFAAEAAAAQAAAAExAAAAYABQAAAAAAEAAAAAcQAAAGAAUAAQAAABAAAAArEQAABAAFABgAAAAQAAAAHBEAAAQABQAAAAAAEAAAAAABAAAEAAUAAAAAABwAAAAUEQAACAAFAPgqAAAAAAAANCEAAAAAAAAQAAAADBEAAAQABQACAAAAEAAAAB8RAAAEAAUAAAAAABAAAAABAQAABAAFAAIAAAAQAAAAIBEAAAQABQAAAAAAEAAAACIRAAAEAAUAAwAAABAAAAAQEQAABAAFAAAAAAAQAAAAAgEAAAQABQAAAAAAEAAAABgRAAAHAAUAAABIQxAAAAAZEQAABwAFAAAASEMQAAAAIxEAAAcABQAAAABDEAAAAAMRAAAHAAUAAAAAABAAAAABEQAABwAFAAAAAAAQAAAACBEAAAcABQAAAIA/EAAAAAGAAAAGAAUAAAAAAA== ScannerJob: properties: jobuid: type: string example: - B3701DC5-86D3-44B6-A8A1-FF0B5D43FD86 status: type: string default: running enum: - pending - running - completed - faulted description: >- If the job is completed, the status will be completed; If faulted, the status will be faulted, e.g. failed to open source, scanner was locked by others... Job status possible transitions: 1. pending->running->completed 2. pending->running->faulted 3. pending->running->canceled scanner: *ref_3 type: object required: - jobuid - status - scanner PageInfo: type: object properties: uid: type: string example: - 190817548d70 description: page uid required: - uid description: page info DocumentInfo: type: object properties: uid: type: string example: - 190807444d76 description: document uid pages: type: array items: $ref: '#/components/schemas/PageInfo' description: page info description: pages info required: - pages - uid description: document info ServerSettingsInput: type: object description: some settings only admin can change. can only update any of them. properties: logLevel: type: integer format: int32 description: 0 is disabled, 30 is verbos, 1 is debug + info + error. example: - 1 ServerSettings: type: object description: Currently, only return log level. properties: logLevel: type: integer format: int32 description: 0 is disabled, 30 is verbos, 1 is debug + info + error example: - 1 required: - logLevel CreateDocumentOptions: type: object properties: password: type: string default: '' maxLength: 32 description: max length is 32 CreateProcessOptions: type: object properties: settings: oneOf: - type: object example: - minBlockHeight: 20 maxBlockHeight: 30 - ImageParameter: Name: BestCoverage BarcodeFormatIds_2: - BF2_POSTALCODE - BF2_DOTCODE DeblurLevel: 9 ExpectedBarcodesCount: 512 ScaleDownThreshold: 100000 LocalizationModes: - Mode: LM_CONNECTED_BLOCKS - Mode: LM_SCAN_DIRECTLY - Mode: LM_STATISTICS - Mode: LM_LINES - Mode: LM_STATISTICS_MARKS GrayscaleTransformationModes: - Mode: GTM_ORIGINAL - Mode: GTM_INVERTED - ImageParameter: Name: Balance BarcodeFormatIds_2: - BF2_POSTALCODE - BF2_DOTCODE DeblurLevel: 5 ExpectedBarcodesCount: 512 LocalizationModes: - Mode: LM_CONNECTED_BLOCKS - Mode: LM_STATISTICS - ImageParameter: Name: BestSpeed BarcodeFormatIds_2: - BF2_POSTALCODE - BF2_DOTCODE DeblurLevel: 3 ExpectedBarcodesCount: 512 LocalizationModes: - Mode: LM_SCAN_DIRECTLY TextFilterModes: - MinImageDimension: 262144 Mode: TFM_GENERAL_CONTOUR properties: {} description: >- for barcode reader, default is coverage template. you can also pass "coverage" or "speed" or "balance". source: oneOf: - type: string description: DWT image url. If it's DWT image url, we should think cors. example: - >- https://127.0.0.1:18623/api/device/scanners/jobs/dd40716d-48d1-4d32-89f7-1d53f9665d91/next-page?page=19522d0c5282 required: - source securitySchemes: {} servers: [] security: []